Questões de Biologia - Simulado de Concurso

Confira e responda questões de Biologia, bio ciência que estuda a vida e os organismos vivos. Essas questões caíram em provas objetivas de Concursos Públicos. Organizadoras: CESPE, IESES, UEM, UniRV, UFMT e outros.

Questão 1

Todos os seres vivos têm suas informações genéticas codificadas pelas sequências de bases nitrogenadas dos ácidos nucleicos. Assinale a alternativa correta, considerando as informações abaixo:

Fita 1 → AAAGATCCCGAATCGGTCGGCGATTTATCG
Fita 2 → TTTCTAGGGCTTAGCCAGCCGCTAAATAGC

Questão 2

A imagem formada a partir do sinal captado na varredura eletrônica de uma superfície pode apresentar diferentes características, uma vez que a imagem resulta da amplificação de um sinal obtido de uma interação entre o feixe eletrônico e o material da amostra. Diferentes sinais podem ser emitidos pela amostra. Os tipos de sinais (elétrons) utilizados na formação de imagens por microscopia eletrônica de varredura são

Questão 3

As células procarióticas e as eucarióticas possuem organelas citoplasmáticas importantes na manutenção do metabolismo celular. Sobre essas organelas, assinale a alternativa correta:

Questão 4

As enzimas são proteínas que atuam como catalisadoras de reações químicas, sendo essenciais para o sistema metabólico de todos os organismos vivos. Frente aos catalizadores químicos, as enzimas possuem algumas vantagens que justificam seu amplo uso. São consideradas vantagens das enzimas sobre os catalizadores químicos, EXCETO.

Questão 5

Durante o processo de replicação do DNA, a enzima primase sintetiza uma molécula de ácido nucleico que é pareada à fita-molde, à qual a DNA polimerase pode ligar o primeiro nucleotídio que fará parte da nova fita. A molécula e o ponto de ligação desse nucleotídio são

Questão 6

De acordo com a sequencia correta da teoria evolutiva, as plantas terrestres podem ser classificadas em:

Questão 7

Há um critério básico na filogenia para a definição de um táxon. Para que um grupo de organismos seja considerado um táxon ele deve ser:

Questão 8

O sistema nervoso é dividido em sistema nervoso central, composto pelo encéfalo e pela medula espinhal, e sistema nervoso periférico, composto pelo tecido nervoso localizado fora do sistema nervoso central. A respeito da morfofisiologia do sistema nervoso, julgue os itens que se seguem.

I - O sistema nervoso, por meio dos impulsos elétricos que ocorrem entre seus neurônios, é capaz de integrar todas as partes do corpo.
II - O sistema nervoso central é o responsável pela transmissão das informações dos sentidos ao sistema nervoso periférico.
III - O sistema nervoso periférico controla a entrada e a saída de estímulos nervosos nos diversos órgãos e sistemas do organismo.
IV - No sistema nervoso periférico, estão arquivadas as memórias.

Estão certos apenas os itens

Questão 9

De acordo com a Primeira e a Segunda Leis de Mendel:

Questão 10

A respeito do tecido epitelial, podemos afirmar:

I – Reveste internamente as cavidades.
II – O epitélio da epiderme é classificado como estratificado pavimentoso queratinizado.
III – Faz contato direto com o tecido conjuntivo subjacente que serve apenas para a sustentação.

É correto afirmar que apenas:

Tempo de simulado:
Informar problema Carregando...

Deixe uma resposta