Questões de Biologia – Simulado de Concurso

Confira e responda questões de Biologia, bio ciência que estuda a vida e os organismos vivos. Essas questões caíram em provas objetivas de Concursos Públicos. Organizadoras: CESPE, IESES, UEM, UniRV, UFMT e outros.

Questão 1

É comum crianças com idade entre 6 meses e 5 anos terem a forma mais frequente de anemia – a anemia ferropriva – causada pela redução da quantidade de hemoglobina no sangue em decorrência da deficiência de ferro.

É INCORRETO afirmar que a deficiência de ferro afeta




Questão 2

Uma proteína de 40 aminoácidos sofreu desnaturação após ter sido exposta a uma alta concentração de ureia. Em seguida, a ureia foi retirada e a proteína retornou ao estado original de conformação enovelada, permitindo que as cadeias laterais de leucina e valina se agrupassem no interior dessa proteína. A explicação para esse fato é que




Questão 3

As células procarióticas e as eucarióticas possuem organelas citoplasmáticas importantes na manutenção do metabolismo celular. Sobre essas organelas, assinale a alternativa correta:




Questão 4

O botulismo é uma intoxicação severa e potencialmente letal causada por neurotoxinas produzidas por bactérias gram-positivas anaeróbicas denominadas Clostridium botulinum. Com relação às estruturas celulares dessas bactérias, assinale a opção correta.




Questão 5

São consideradas técnicas aplicadas na manipulação genética de plantas, EXCETO.




Questão 6

Analise as afirmações sobre as características gerais das aves e assinale a alternativa INCORRETA:




Questão 7

O ácido fólico é uma vitamina do complexo B e é, também, conhecido pelos nomes folato e vitamina B9. Essa vitamina atua na transformação e síntese de proteínas. Além disso, auxilia a divisão celular e, consequentemente, o crescimento dos tecidos. Sobre o ácido fólico, marque V para as afirmativas verdadeiras e F para as falsas.

() Impede malformações do tubo neural do bebê, durante a gestação: anencefalia e espinha bífida (exposição da medula espinhal) e lábio leporino.
() O ácido fólico tem importante papel na oncologia, principalmente a partir da sua ação como cofator na metilação do DNA e na síntese de purinas e pirimidinas.
() O ácido fólico é biossintetizado pelas plantas: a porção de pteridina é produzida no citosol, a de PABA (ácido para-aminobenzoico) é formada em plastídios, e as duas são acopladas e glutamiladas nas mitocôndrias das células vegetais.

Assinale a sequência correta.




Questão 8

Há um critério básico na filogenia para a definição de um táxon. Para que um grupo de organismos seja considerado um táxon ele deve ser:




Questão 9

Todos os seres vivos têm suas informações genéticas codificadas pelas sequências de bases nitrogenadas dos ácidos nucleicos. Assinale a alternativa correta, considerando as informações abaixo:

Fita 1 → AAAGATCCCGAATCGGTCGGCGATTTATCG
Fita 2 → TTTCTAGGGCTTAGCCAGCCGCTAAATAGC




Questão 10

A imagem formada a partir do sinal captado na varredura eletrônica de uma superfície pode apresentar diferentes características, uma vez que a imagem resulta da amplificação de um sinal obtido de uma interação entre o feixe eletrônico e o material da amostra. Diferentes sinais podem ser emitidos pela amostra. Os tipos de sinais (elétrons) utilizados na formação de imagens por microscopia eletrônica de varredura são




Tempo de simulado:

Deixe uma resposta