Questões de Biologia – Simulado de Concurso

Confira e responda questões de Biologia, bio ciência que estuda a vida e os organismos vivos. Essas questões caíram em provas objetivas de Concursos Públicos. Organizadoras: CESPE, IESES, UEM, UniRV, UFMT e outros.

Questão 1

As plantas C4 desenvolveram mecanismos de concentração de CO2 os quais contribuem para reduzir a fotorrespiração, o que pode representar vantagens ou desvantagens para esse tipo de planta. Sobre as vantagens do mecanismo de concentração de CO2 das plantas C4, é INCORRETO afirmar que:




Questão 2

O câncer de próstata é o mais frequente nos homens e o segundo maior causador de mortes no Brasil. Segundo a Sociedade Brasileira de Urologia, estima-se que 400 mil pessoas acima de 45 anos, ou seja, um em cada seis homens pode ter a doença.

São fatores que contribuem para esse grande número de casos de câncer de próstata, EXCETO




Questão 3

A respeito do desenvolvimento embrionário, assinale a assertiva correta.




Questão 4

Os tecidos conjuntivos caracterizam-se por apresentar diversos tipos de células imersas em material extracelular sintetizado por elas. Com relação aos tecidos conjuntivos, assinale a alternativa correta:




Questão 5

Analise as afirmações sobre as características gerais das aves e assinale a alternativa INCORRETA:




Questão 6

Em uma cultura de fibroblastos, células produtoras de colágeno existentes em locais como a derme, foi adicionado um aminoácido radioativo. Após intervalos regulares de tempo, a localização do aminoácido radioativo dentro da célula foi determinada por uma técnica de impregnação com prata.

Assinale a alternativa que representa o trajeto a ser percorrido pelo aminoácido no interior da célula.




Questão 7

O fígado é considerado uma glândula mista. São funções do fígado, exceto:




Questão 8

A “doença dos pontos brancos” ou ictiofitiríase é causada pelo protozoário Ichthyophthirius multifiliis, um ectoparasita encontrado no mundo inteiro, responsável pelos maiores prejuízos nas pisciculturas de água doce. Sobre essa doença pode-se afirmar que:

I. Ocorre principalmente em pisciculturas onde há oscilações térmicas bruscas ou que possuem qualidade de água inadequada, favorecendo o aparecimento da doença devido ao estresse dos peixes.
II. Os sinais característicos da presença deste protozoário são a descamação dos peixes, corrosão das nadadeiras e presença de pontos brancos na pele e nas brânquias.
III. É uma enfermidade difícil de ser tratada. O uso de banhos terapêuticos com cloreto de sódio ou formalina comercial pode ser recomendado para tratamento.
IV. A retirada dos peixes infestados por estes parasitas dos tanques impede a proliferação da doença.




Questão 9

Todos os seres vivos têm suas informações genéticas codificadas pelas sequências de bases nitrogenadas dos ácidos nucleicos. Assinale a alternativa correta, considerando as informações abaixo:

Fita 1 → AAAGATCCCGAATCGGTCGGCGATTTATCG
Fita 2 → TTTCTAGGGCTTAGCCAGCCGCTAAATAGC




Questão 10

Durante o processo de replicação do DNA, a enzima primase sintetiza uma molécula de ácido nucleico que é pareada à fita-molde, à qual a DNA polimerase pode ligar o primeiro nucleotídio que fará parte da nova fita. A molécula e o ponto de ligação desse nucleotídio são




Tempo de simulado:

Deixe uma resposta